BIOPHYSICAL STUDIES ON ANTHRAQUINONE DERIVATIVES BINDING TO G-QUADRUPLEX SEQUENCES AND THEIR ANTI-CANCER/ANTI-TUBERCULOSIS POTENTIAL

Abstract

Anthraquinones also known as 9,10-dioxoanthracenes or anthracene diones) are a class of natural and synthetic compounds with various applications. Anthraquinone-based compounds are now widely used in cancer chemotherapy and antibacterial, antifungal, and antiviral activity, with the naturally derived aminoglycoside anthracycline doxorubicin and synthesized aminoanthraquinone mitoxantrone in clinical use. Anthraquinone inhibits ATP hydrolysis by interfering with the function of type II topoisomerases. It disrupts DNA topology by forming a transient double-strand through the stabilization of the topoisomerase II-DNA cleavage complex. Most anthraquinone-based compounds inhibit cancer progression by interacting with essential cellular proteins such as kinases, topoisomerases, telomerase, and metalloproteinases. Anthraquinone derivative, like mitoxantrone, inhibited DNA synthesis in the S-phase. Modifying the side chain structure of anthraquinones may improve their anticancer efficacy. Anthraquinone, according to new research, affects telomere maintenance. In contrast, the human telomeric end contains a G-rich repetitive sequence that can form a single-stranded DNA template at the 3′ ends of human telomeres, known as G-quadruplex(G4) DNA. Beyond the double helix, the G4 DNA structure is a noncanonical tetraplex with four guanines in a plane held together by Hoogsteen hydrogen binding in the presence of K+/Na+ cations. G-quadruplex structure was discovered not only at the telomeric end as well as in the promoter regions of numerous oncogenes in cancer cells, viruses, and bacteria. While the ribonucleoprotein enzyme telomerase is not expressed in normal human cells, it is found in at least 85% of cancerous cells, suggesting a correlation between telomerase and the progression and distant metastasis. The cells gain immortality when the telomerase enzyme is turned on in tumor cells. The RNA template and end-capping activities require an extended single-stranded DNA primer. In mammalian cells, folding G-rich repeats into elevated G4 DNA structures has been observed and has been found to prevent these processes. The binding of small molecules to the G4 quartet interferes in DNA damage response signaling, oncogene protein expression, and genomic stability and therefore acts as a transcriptional regulator of different mechanisms. As a result of their selectivity, Gquadruplex binding ligands can be used as a prominent therapeutic strategy because they have no cytotoxic activity outside of the tumor. Anthraquinones bind to different forms of DNA, cause telomere dysfunction, and impose their influence using multiple approaches involving complex mechanisms which are not fully understood. A comprehensive study of the interaction of two synthesized derivatives of 2,6 diamino anthraquinones with wild type 26-mer(wHTel26) intramolecular 3+1 (parallel/antiparallel) d[TT(AGGGTT)4] and 22-mer (HTel22) d-[AGGG(TTAGGG)3] is presented in this thesis. This thesis also contains the interaction of mitoxantrone and emodin to mosR (d- TGGGCTAGCTCTAGGGGGCAGGGCTTTGACGGGT) and ndhA (d- TGGGCCTTGTGGGCCTTGTGGGCCTTGTGGGT) genes Absorption, steady state and life time fluorescence, and Circular Dichroism (CD) spectroscopy were used to study G4 DNA contains human telomeric DNA sequence binding to ligands. Molecular docking studies have been used to supplement the investigations. Surface Plasmon Resonance was used to determine real-time binding affinity (SPR). CD and Differential Scanning Calorimetry (DSC) were used to determine the melting profiles of DNA. Isothermal calorimetry (ITC) is used to study thermodynamic profiling and the binding affinity of DNA complexes with ligands. The MTT cell viability assay was used to assess cellular toxicity. Fluorescence microscopy with dyes was used to examine nuclear condensation and reactive oxygen species. qRT-PCR demonstrated transcriptional study. The annexin V-FITC assay was used to investigate the apoptotic cell stages of MCF7 cells. Finally, western blot analysis was used to study protein-level expression in the apoptotic cell. In mycobacteria tuberculosis, an Alamar blue assay was used for the inhibitory analysis concentration of ligands. The thesis is divided into seven chapters. Chapter 1 covers the basic DNA structure, different types of DNA, telomeric DNA, the telomerase enzyme, and cellular activities. A review of the literature on different derivatives of anthraquinones binding to duplex DNA, anthraquinone effect on bacteria, viruses, and also in fungi, the ligand-quadruplex DNA interactions determined by various biophysical methods, the structure of ligand-G4 DNA complexes determined by X-ray/NMR techniques, corroboration of disruption of telomerase from telomere resulting telomere impairment by anthraquinones, and other topics have been discussed. Chapter 2 contains materials and methods for conducting biophysical and structural studies on ligand interactions with specific G4 DNA sequences. The mathematical models for fitting experimental data and the equations used to obtain binding parameters such as affinity constant, quenching constant, stoichiometry of ligand-DNA complexes, and so on from UV-visible absorption, steady-state and time-resolved fluorescence, and CD spectra are provided. The techniques of SPR, DSC, and ITC for determining binding affinity and thermal melting profiles, respectively, are discussed. Molecular docking is used to estimate the hydrogen bonding energy of a complex. Cell viability assay, ROS assay, qRT-PCR, annexin V-FITC assay, western blot, and fluorescence microscopy were used to investigate the effect of ligands on MCF7 cancer cells and the H37Rv mycobacterial strain. Chapter 3 comprises the synthesis procedure and NMR peak for characterization of 2, 6-Bis [(3- piperidine)acetamido)]anthracene-9,10-dione (N-1P), 2,6-Bis [(3- diethylamino)acetamido)]anthracene-9,10-dione (N-1DEA), 2,6-Bis [(3- piperidine)propinamidomido)]anthracene-9,10-dione (N-2P) and Synthesis of 2, 6-Bis [(3- diethylamino)propinamidomido)]anthracene-9,10-dione (N-2DEA). Chapter 4 demonstrated that the binding affinity of N-2DEA and N-1DEA are Kb = 4.8×106 M-1 and Kb = 7.6×105 M-1, respectively, leading to hypochromism, fluorescence quenching with minor red shift and ellipticity variations indicating ligand binding in the external groove. We found that sodium ions induced stabilization more rather than potassium ions. The molecular docking of a complex demonstrates a molecule's exterior binding to a quadruplex. The investigation of ROS activity indicated that the cell initiates mortality in response to the IC50 concentration. Cellular morphology, nuclear condensation, and fragmentation were altered in the treated cell, impairing cellular function. Finally, the transcriptional regulatory study paves the way for drug design as an anti-cancer agent due to the tremendous possibilities of changing substituent groups on anthraquinones to improve efficacy and selectivity for G-quartet DNA. Our research focused on how ligand binding to telomere sequences induces oxidative stress and inhibits the growth of malignant cells. Chapter 5 employed biophysical approaches to explore the interaction of synthetic anthraquinone derivatives with quadruplex DNA sequences to influence biological activities in the presence of K+ and Na+ cations. The binding affinity for N-2P and N-1P are Kb = 5.8×106 M-1 and Kb = 1.0×106 M-1, respectively, leading to hypo/hyperchromism with 5–7 nm red shift and significant fluorescence quenching and changes in ellipticity resulting in external binding of both the ligands to G-quadruplex DNA. Ligand binding induced enhancement of thermostability of G4 DNA is more significant in the Na+ environment (Tm = 34 ℃) as compared to that in the K+ environment (Tm = 21 ℃), thereby restricting telomerase binding access to telomeres. Microscopic images of treated cells indicated cellular shape, nuclear condensation, and fragmentation alterations. The findings pave the path for therapeutic research, given the great potential of modifying anthraquinone substituent groups towards improved efficacy, ROS generation, and G-quadruplex DNA selectivity. Chapter 6 demonstrated that mitoxantrone (anthraquinone) binds to G4 DNA forming genes, mosR and ndhA, (affinity constant ~105-107 M-1) essential for oxidation sensing regulation and ATP generation, respectively, making tuberculosis disease-causing Mycobacterium tuberculosis (Mtb) bacteria susceptible to oxidative stress inside host cells. Interaction of mitoxantrone to G4 DNA leads to hypochromism/hyperchromism with red shift ~18 nm, quenching/enhancement of fluorescence, and change in conformation of hybrid G4 DNA due to formation of multiple stoichiometric complexes with dual binding mode. External binding by partial stacking with Gquartets and at groove/loop, inducing thermal stabilization ~20-29 ºC, leads to two/four-fold down-regulation of transcriptomes of mosR/ndhA genes apart from growth inhibition and suppression of Taq polymerase action, suggesting an alternate strategy for effective antituberculosis treatment in view of deadly multi-drug resistant strains. Chapter 7 contains the observed hypochromism, red shift ~6-11 nm, fluorescence quenching, shortening of fluorescence lifetime, and appearance of negative induced circular dichroism band during the interaction, suggesting binding of emodin to grooves/loops and end stacking with guanine quartets. The thermodynamically favorable reaction, involving a non-intercalative binding mechanism in two distinct modes, is enthalpy driven with an affinity constant ~6x104 M- 1. Inhibition of bacterial growth, Taq polymerase enzyme, and significant downregulation of mosR and ndhA genes (2-4 orders) by emodin may be attributed to binding-induced thermal stabilization, ΔTm ~23 and 14 °C in ndhA and mosR G4 DNA complexes, respectively. The studies demonstrate G4 DNA as a promising pharmacological target for developing effective anti-tuberculosis treatments and the therapeutic potential of emodin in targeting pathogen persistence genes, mainly because of emerging multi-drug resistant deadly strains.